XB-FEAT-479875

From Xenbase
Jump to: navigation, search

pax5

This is the community wiki page for the gene pax5 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos have been designed for this gene with a sequence
GGTCGTGCTTACAGTGTATTTCCAT


which was used in [1]