XB-FEAT-5949004

From Xenbase
Jump to: navigation, search

gabrg2

This is the community wiki page for the gene gabrg2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

A morpholino has been designed for this gene with sequences
GATCGCATCTCTCGTCGCGTTTCGA(translation blocking)

which was used in [1]