XB-FEAT-6465756

From Xenbase
Jump to: navigation, search

A morpholino has been designed for this gene with sequence GCAGACGGAGGAAGCCATTTATTCT which was used in [1]