XB-FEAT-5995151
From Xenbase
smad4.2
This is the community wiki page for the gene smad4.2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CGCCATCTTTTGCCCTTGTTGTTAC (5' UTR / translation blocking)
which were used in [1]