XB-FEAT-982290

From XenWiki
(Redirected from Apxl)
Jump to navigation Jump to search

shroom2

This is the community wiki page for the gene shroom2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TACTACCATACACACCTTGACAAGT

which were used in [1]