View source for XB-MORPHOLINO-17251707

← XB-MORPHOLINO-17251707

Jump to navigation Jump to search

You do not have permission to edit this page, for the following reason:

The action you have requested is limited to users in the group: Users.

You can view and copy the source of this page.

Note that the published sequence differs from the genomic sequence as provided by JGI.  The authors insert an additional T into this genomic-based sequence: 
GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA

Return to XB-MORPHOLINO-17251707.

Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-MORPHOLINO-17251707"