XB-MORPHOLINO-17251707 and XB-MORPHOLINO-17250253: Difference between pages

From XenWiki
(Difference between pages)
Jump to navigation Jump to search
imported>Kevin
(Created page with "Note that the published sequence differs from the genomic sequence as provided by JGI. The authors insert an additional T into this genomic-based sequence: GCGTGCCTCGTCTGGG ...")
 
imported>Kevin
(Created page with "This morpholino was previously named rnf121 MO1 and its target was entered as rnf121, therefore the XB scripts calculated off target/ on target information relative to rnf121 ...")
 
Line 1: Line 1:
Note that the published sequence differs from the genomic sequence as provided by JGI.  The authors insert an additional T into this genomic-based sequence:
This morpholino was previously named rnf121 MO1 and its target was entered as rnf121, therefore the XB scripts calculated off target/ on target information relative to rnf121 and not eph4b.  However, eph4b is the appropriate target and this construct targets its ATG site in laevis 25/25, see the match for gene model Xelaev16003704m.  The change to eph4b was performed on 5/20/2015 and we anticipate a refresh of this morpholino's hits to occur when a secondary set of morpholino curation scripts have been completed.
GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA

Latest revision as of 08:04, 21 May 2015

This morpholino was previously named rnf121 MO1 and its target was entered as rnf121, therefore the XB scripts calculated off target/ on target information relative to rnf121 and not eph4b. However, eph4b is the appropriate target and this construct targets its ATG site in laevis 25/25, see the match for gene model Xelaev16003704m. The change to eph4b was performed on 5/20/2015 and we anticipate a refresh of this morpholino's hits to occur when a secondary set of morpholino curation scripts have been completed.