XB-MORPHOLINO-17251707: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin (Created page with "Note that the published sequence differs from the genomic sequence as provided by JGI. The authors insert an additional T into this genomic-based sequence: GCGTGCCTCGTCTGGG ...") |
(No difference)
|
Revision as of 07:22, 25 February 2015
Note that the published sequence differs from the genomic sequence as provided by JGI. The authors insert an additional T into this genomic-based sequence: GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA