XB-FEAT-481479: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase
imported>Xenbase
Line 28: Line 28:




==Available Reagents==


=Morpholino Oligonucleotides=
=Morpholino Oligonucleotides=

Revision as of 10:33, 31 August 2020

tptep2-csnk1e

This is the community wiki page for the gene tptep2-csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

01/6/15 Changed symbol to csnk1e and added previous name as synonym

01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E

04/22/ 2016 Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon

06/19/2017 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E


05/08/2018 The human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E

09.23.2018

Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E

15June 2020

Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E readthrough


Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC


which were used in [1]