XB-FEAT-6465756: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

12 November 2012

  • curprev 09:5709:57, 12 November 2012‎ imported>Kevin‎ 180 bytes +180‎ Created page with "A morpholino has been designed for this gene with sequence GCAGACGGAGGAAGCCATTTATTCT which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41082]"
Retrieved from "https://wiki.xenbase.org/xenwiki/index.php?title=XB-FEAT-6465756"