XB-FEAT-853107

From Xenbase
Revision as of 18:33, 12 November 2012 by Anonymous (talk)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

en2

This is the community wiki page for the gene en2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos have been designed for this gene with a sequence CATTCTCTTCCATGCTGTTCCCC


which was used in [1]