XB-FEAT-486800

From XenWiki
Revision as of 10:35, 12 November 2012 by imported>Kevin
Jump to navigation Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

pax2

This is the community wiki page for the gene pax2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos have been designed for this gene with sequences TGCAGTGCATATCCATGGGGAGGCA GGTCTGCCTTGCAGTGCATATCCAT

which were used in [1]