XB-FEAT-855943: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin (→h2afx) |
imported>JoshuaFortriede (→h2afxl) |
||
Line 1: | Line 1: | ||
= | =h2afxl= | ||
This is the community wiki page for the gene '' | This is the community wiki page for the gene ''h2afxl'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Nomenclature == | |||
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. | |||
==Available Reagents== | ==Available Reagents== |
Revision as of 12:05, 3 July 2019
h2afxl
This is the community wiki page for the gene h2afxl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Nomenclature
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.