XB-FEAT-919663

From XenWiki
Jump to navigation Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

ventx2

This is the community wiki page for the gene ventx2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TTCCTGTAGTAGTCCTTGTGTTCAT


which were used in [1]

nomenclature changes

1MAY2023

Xenopus gene symbol was changed from ventx2.1 to ventx2