XB-FEAT-854157

From XenWiki
Revision as of 12:38, 7 January 2013 by imported>Kevin
Jump to navigation Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

wnt11

This is the community wiki page for the gene wnt11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences

CTTCATCTTCAAAACCCAATAACAA

which was used in [1],[2],[3]

and

ACTGTATCCAAAGAGAGTTCCGAGG

which was used in [4]