XB-FEAT-966993

From Xenbase
Jump to: navigation, search

gmnn

This is the community wiki page for the gene gmnn please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene and a currently uncurated orthologue with sequences
ATCTCTGCTTCTTGTTGGTATTCAT (Geminin H)

which were used in [1][2][3]

TAAGCCTCTGCTCTTTTCACGCACA (Geminin L)

which were used in [4]