XB-FEAT-5949004: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
=gabrg2= | =gabrg2= | ||
This is the community wiki page for the gene ''gabrg2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''gabrg2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
A morpholino has been designed for this gene with sequences <br /> | |||
GATCGCATCTCTCGTCGCGTTTCGA(translation blocking)<br /> | |||
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=43270] | |||
Latest revision as of 08:31, 13 November 2012
gabrg2
This is the community wiki page for the gene gabrg2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
A morpholino has been designed for this gene with sequences
GATCGCATCTCTCGTCGCGTTTCGA(translation blocking)
which was used in [1]