XB-FEAT-484970: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Christina |
||
| (4 intermediate revisions by 2 users not shown) | |||
| Line 1: | Line 1: | ||
=cer1= | =cer1= | ||
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | |||
HGNC records the following previous names and synonyms for cer1: | |||
"cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", | |||
"cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)" | |||
=available reagents= | |||
==Morpholino Oligonucleotides== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CTAGACCCTGCAGTGTTTCTGAGCG <br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=34935] | |||
Latest revision as of 11:28, 6 August 2015
cer1
This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"
available reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG
which were used in [1]