XB-FEAT-484970: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
imported>Christina
 
(4 intermediate revisions by 2 users not shown)
Line 1: Line 1:
=cer1=  
=cer1=  
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
=nomenclature changes=
HGNC records the following previous names and synonyms for cer1:
"cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)",
"cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"
=available reagents=
==Morpholino Oligonucleotides==
Morpholinos have been designed for this gene with sequences <br />
CTAGACCCTGCAGTGTTTCTGAGCG <br />
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=34935]

Latest revision as of 11:28, 6 August 2015

cer1

This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"

available reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG

which were used in [1]