XB-FEAT-486800: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Kevin
No edit summary
imported>Xenbase
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
=pax2=  
=pax2=  
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
 
Morpholinos have been designed for this gene with sequences <br />
TGCAGTGCATATCCATGGGGAGGCA <br />
GGTCTGCCTTGCAGTGCATATCCAT
 
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202]

Latest revision as of 11:34, 21 October 2021

pax2

This is the community wiki page for the gene pax2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.