XB-FEAT-854157: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
imported>Xenbase
No edit summary
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
=wnt11=  
=wnt11=  
This is the community wiki page for the gene ''wnt11'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''wnt11'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
==Available Reagents==
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
CTTCATCTTCAAAACCCAATAACAA
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514],[http://www.xenbase.org/literature/article.do?method=display&articleId=35204],[http://www.xenbase.org/literature/article.do?method=display&articleId=2331]
and
ACTGTATCCAAAGAGAGTTCCGAGG <br />
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514]
=nomenclature changes=
04/22/ 2016
Human name has changed for Entrez Gene: 7481. From wingless-type MMTV integration site family member 11 to Wnt family member 11

Latest revision as of 08:22, 22 May 2017

wnt11

This is the community wiki page for the gene wnt11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences

CTTCATCTTCAAAACCCAATAACAA

which was used in [1],[2],[3]

and

ACTGTATCCAAAGAGAGTTCCGAGG

which was used in [4]

nomenclature changes

04/22/ 2016

Human name has changed for Entrez Gene: 7481. From wingless-type MMTV integration site family member 11 to Wnt family member 11