XB-FEAT-855461: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
imported>Xenbase
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
=tcf7=  
=tcf7=  
This is the community wiki page for the gene ''tcf7'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''tcf7'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
=Morpholinos=
the following Morpholino was designed for this gene with a sequence <br />
CGGCGCTGTTCATTTGGGGCAT<br />
This MO was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202], [http://www.xenbase.org/literature/article.do?method=display&articleId=1087], [http://www.xenbase.org/literature/article.do?method=display&articleId=45318]
=nomenclature changes=
05/15/2017
Human name has changed for Entrez Gene: 6932. From transcription factor 7 (T-cell specific, HMG-box) to transcription factor 7

Latest revision as of 07:38, 16 May 2017

tcf7

This is the community wiki page for the gene tcf7 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos

the following Morpholino was designed for this gene with a sequence
CGGCGCTGTTCATTTGGGGCAT

This MO was used in [1], [2], [3]


nomenclature changes

05/15/2017 Human name has changed for Entrez Gene: 6932. From transcription factor 7 (T-cell specific, HMG-box) to transcription factor 7