XB-FEAT-922931: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Xenbase No edit summary |
||
| (One intermediate revision by one other user not shown) | |||
| Line 1: | Line 1: | ||
=ntrk2= | =ntrk2= | ||
This is the community wiki page for the gene ''ntrk2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''ntrk2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CCACTGGATCCCCCCTAGAATGGAG <br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=3371] | |||
=nomenclature changes= | |||
04/22/ 2016 | |||
Human name has changed for Entrez Gene: 4915. From neurotrophic tyrosine kinase, receptor, type 2 to neurotrophic receptor tyrosine kinase 2 | |||
Latest revision as of 08:44, 7 June 2017
ntrk2
This is the community wiki page for the gene ntrk2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CCACTGGATCCCCCCTAGAATGGAG
which were used in [1]
nomenclature changes
04/22/ 2016
Human name has changed for Entrez Gene: 4915. From neurotrophic tyrosine kinase, receptor, type 2 to neurotrophic receptor tyrosine kinase 2