XB-FEAT-948087: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Xenbase No edit summary |
||
(One intermediate revision by one other user not shown) | |||
Line 1: | Line 1: | ||
=fkbp4= | =fkbp4= | ||
This is the community wiki page for the gene ''fkbp4'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''fkbp4'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CGGTCTTCATCTCCTCGGCAGTCAT (Homeolog A)<br /> | |||
CAGGCTTCATCTCGTCAGCAGTCAT (Homeolog B)<br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=40834] | |||
=Nomenclature updates= | |||
11/06/2018 | |||
Human name has changed for Entrez Gene: 2288. From FK506 binding protein 4 to FKBP prolyl isomerase 4 |
Latest revision as of 13:49, 6 November 2018
fkbp4
This is the community wiki page for the gene fkbp4 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CGGTCTTCATCTCCTCGGCAGTCAT (Homeolog A)
CAGGCTTCATCTCGTCAGCAGTCAT (Homeolog B)
which were used in [1]
Nomenclature updates
11/06/2018 Human name has changed for Entrez Gene: 2288. From FK506 binding protein 4 to FKBP prolyl isomerase 4