XB-FEAT-481479: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Christina
 
(14 intermediate revisions by 3 users not shown)
Line 1: Line 1:
=csnk1e=  
=csnk1e=  
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
=summary for Human CSNK1E from NCBI=
CSNK1E - casein kinase 1 epsilon
The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]


=nomenclature changes=
=nomenclature changes=
Line 9: Line 14:
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E


04/22/ 2016
Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon
06/19/2017
Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
05/08/2018
The human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E
09.23.2018
Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E
15June2020
Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E readthrough
17JULY2022


==Available Reagents==
Human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
TCCCCACTCTCAGCTCCATGTTTAC <br />


which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014]
''Xenopus'' symbol changed from tptep2-csnk1e to csnk1e

Latest revision as of 12:25, 28 July 2022

csnk1e

This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

summary for Human CSNK1E from NCBI

CSNK1E - casein kinase 1 epsilon

The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]

nomenclature changes

01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

01/6/15 Changed symbol to csnk1e and added previous name as synonym

01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E

04/22/ 2016 Human name has changed for Entrez Gene: 1454. From casein kinase 1, epsilon to casein kinase 1 epsilon

06/19/2017 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E


05/08/2018 The human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E

09.23.2018

Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E

15June2020

Human symbol has changed for genepage ID: 481479 From csnk1e to TPTEP2-CSNK1E readthrough

17JULY2022

Human symbol has changed for genepage ID: 481479 From tptep2-csnk1e to CSNK1E

Xenopus symbol changed from tptep2-csnk1e to csnk1e