XB-FEAT-493412: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
|||
| (One intermediate revision by one other user not shown) | |||
| Line 1: | Line 1: | ||
=arfgap3= | =''arfgap3''= | ||
This is the community wiki page for the gene ''arfgap3'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''arfgap3'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase. | ||
=nomenclature changes= | |||
29OCT202 | |||
Human symbol has changed for Entrez Gene: 26286. From ARF GTPase activating protein 3 to arfgap3 | |||
Human name has changed for Entrez Gene: 26286. From ADP ribosylation factor GTPase activating protein 3 to ARF GTPase activating protein 3 | |||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CGGTTCCGCCATTCTCCGTCTCTCT <br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=150] | |||
Latest revision as of 11:45, 30 October 2024
arfgap3
This is the community wiki page for the gene arfgap3 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
29OCT202
Human symbol has changed for Entrez Gene: 26286. From ARF GTPase activating protein 3 to arfgap3
Human name has changed for Entrez Gene: 26286. From ADP ribosylation factor GTPase activating protein 3 to ARF GTPase activating protein 3
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CGGTTCCGCCATTCTCCGTCTCTCT
which were used in [1]