XB-FEAT-5719326: Difference between revisions
imported>Kevin No edit summary |
imported>Xenbase |
||
(2 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
= | =h2ac21= | ||
This is the community wiki page for the gene '' | This is the community wiki page for the gene ''h2ac21'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | |||
08.23.2019 | |||
Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21 | |||
Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21 | |||
Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21 | |||
=Summary for human from NCBI= | |||
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Aug 2015] | |||
==Available Reagents== | ==Available Reagents== | ||
Line 7: | Line 20: | ||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
TGACGGCTTTTCCTCTGCCCGACAT <br /> | TGACGGCTTTTCCTCTGCCCGACAT <br /> | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | |||
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive. | This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive. | ||
Latest revision as of 08:20, 26 August 2019
h2ac21
This is the community wiki page for the gene h2ac21 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
08.23.2019
Human name has changed for Entrez Gene: 317772. From histone cluster 2 H2A family member b to H2A clustered histone 21
Human symbol has changed for genepage ID: 5719326 From hist2h2ab to h2ac21
Human symbol has changed for Entrez Gene: 317772. From HIST2H2AB to H2AC21
Summary for human from NCBI
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.