XB-FEAT-486360: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Xenbase No edit summary |
||
| Line 9: | Line 9: | ||
CATGAAAATCGAGGAGGTGAAGAGC <br /> | CATGAAAATCGAGGAGGTGAAGAGC <br /> | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=2077] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=2077] | ||
=nomenclature changes= | |||
04/22/ 2016 | |||
Human name has changed for Entrez Gene: 8607. From RuvB-like AAA ATPase 1 to RuvB like AAA ATPase 1 | |||
Latest revision as of 08:00, 26 April 2017
ruvbl1
This is the community wiki page for the gene ruvbl1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CATGAAAATCGAGGAGGTGAAGAGC
which were used in [1]
nomenclature changes
04/22/ 2016
Human name has changed for Entrez Gene: 8607. From RuvB-like AAA ATPase 1 to RuvB like AAA ATPase 1