XB-FEAT-486854: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
=tbx5= | =tbx5= | ||
This is the community wiki page for the gene ''tbx5'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''tbx5'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
TTAGGAAAGTGTCTCTGGTGTTGCC <br /> | |||
CATAAGCCTCCTCTGTGTCCGCCAT <br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=2506] | |||
Latest revision as of 08:25, 9 January 2013
tbx5
This is the community wiki page for the gene tbx5 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TTAGGAAAGTGTCTCTGGTGTTGCC
CATAAGCCTCCTCTGTGTCCGCCAT
which were used in [1]