XB-FEAT-920500: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
|||
| (One intermediate revision by the same user not shown) | |||
| Line 1: | Line 1: | ||
=ventx1 | =''ventx1''= | ||
This is the community wiki page for the gene ''ventx1 | This is the community wiki page for the gene ''ventx1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase. | ||
=nomenclature changes= | |||
1MAY2023 | |||
''Xenopus'' gene symbol was changed from ''ventx1.1'' to ''ventx1'' | |||
==Available Reagents== | ==Available Reagents== | ||
| Line 7: | Line 14: | ||
CAATAGAGAATCCCTGTTGAACCAT <br /> | CAATAGAGAATCCCTGTTGAACCAT <br /> | ||
This morpholino is 100% conserved against the | This morpholino is 100% conserved against the homeolog ventx1.2 | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7052] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7052] | ||
Latest revision as of 09:44, 1 May 2023
ventx1
This is the community wiki page for the gene ventx1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
1MAY2023
Xenopus gene symbol was changed from ventx1.1 to ventx1
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CAATAGAGAATCCCTGTTGAACCAT
This morpholino is 100% conserved against the homeolog ventx1.2
which were used in [1]