XB-FEAT-5719326: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
=hist2h2ab= | =hist2h2ab= | ||
This is the community wiki page for the gene ''hist2h2ab'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''hist2h2ab'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
TGACGGCTTTTCCTCTGCCCGACAT <br /> | |||
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive. | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | |||
Revision as of 11:04, 19 November 2012
hist2h2ab
This is the community wiki page for the gene hist2h2ab please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.
which were used in [1]