XB-FEAT-484685: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin |
||
| Line 1: | Line 1: | ||
=smad9= | =smad9= | ||
This is the community wiki page for the gene ''smad9'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''smad9'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
A morpholino has been designed for this gene with sequence TGCATTGGATTTGCTGTGTTTACC which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=40165] | |||
Latest revision as of 08:33, 12 November 2012
smad9
This is the community wiki page for the gene smad9 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
A morpholino has been designed for this gene with sequence TGCATTGGATTTGCTGTGTTTACC which was used in [1]