XB-FEAT-486800: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
=pax2= | =pax2= | ||
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
Morpholinos have been designed for this gene with sequences | |||
TGCAGTGCATATCCATGGGGAGGCA | |||
GGTCTGCCTTGCAGTGCATATCCAT | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202] | |||
Revision as of 09:35, 12 November 2012
pax2
This is the community wiki page for the gene pax2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Morpholinos have been designed for this gene with sequences TGCAGTGCATATCCATGGGGAGGCA GGTCTGCCTTGCAGTGCATATCCAT
which were used in [1]