XB-FEAT-854157: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
=wnt11= | =wnt11= | ||
This is the community wiki page for the gene ''wnt11'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''wnt11'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
CTTCATCTTCAAAACCCAATAACAA | |||
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514],[http://www.xenbase.org/literature/article.do?method=display&articleId=35204],[http://www.xenbase.org/literature/article.do?method=display&articleId=2331] | |||
and | |||
ACTGTATCCAAAGAGAGTTCCGAGG <br /> | |||
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514] | |||
Revision as of 11:38, 7 January 2013
wnt11
This is the community wiki page for the gene wnt11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CTTCATCTTCAAAACCCAATAACAA
and
ACTGTATCCAAAGAGAGTTCCGAGG
which was used in [4]