XB-FEAT-855943: Difference between revisions
imported>Xenbase |
imported>Xenbase |
||
| Line 1: | Line 1: | ||
= | = h2axl = | ||
This is the community wiki page for the gene '' | This is the community wiki page for the gene ''h2axl'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | =nomenclature changes= | ||
Revision as of 07:51, 26 August 2019
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
08.23.2019
Human symbol has changed for genepage ID: 855943 From h2afxl to h2aX Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
08.26.19 As Xenopus follows human nomenlcature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.