XB-FEAT-919663: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
|||
| Line 1: | Line 1: | ||
=ventx2 | =''ventx2''= | ||
This is the community wiki page for the gene ''ventx2 | This is the community wiki page for the gene ''ventx2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | ==Available Reagents== | ||
| Line 9: | Line 9: | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7052] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7052] | ||
=nomenclature changes= | |||
1MAY2023 | |||
''Xenopus'' gene symbol was changed from ''ventx2.1'' to ''ventx2'' | |||
Latest revision as of 09:46, 1 May 2023
ventx2
This is the community wiki page for the gene ventx2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TTCCTGTAGTAGTCCTTGTGTTCAT
which were used in [1]
nomenclature changes
1MAY2023
Xenopus gene symbol was changed from ventx2.1 to ventx2