XB-MORPHOLINO-17251707: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin Created page with "Note that the published sequence differs from the genomic sequence as provided by JGI. The authors insert an additional T into this genomic-based sequence: GCGTGCCTCGTCTGGG ..." |
imported>Kevin No edit summary |
||
| Line 1: | Line 1: | ||
Note that the published sequence differs from the genomic sequence as provided by JGI. The | Note that the published sequence differs from the genomic sequence as provided by JGI. The published morpholino has an additional T relative to this genomic-based sequence: | ||
GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA | GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA | ||
Latest revision as of 06:34, 25 February 2015
Note that the published sequence differs from the genomic sequence as provided by JGI. The published morpholino has an additional T relative to this genomic-based sequence: GCGTGCCTCGTCTGGG CGCCGCCATCTTACTTGTGGTCA CGTGCCTA