XB-FEAT-482276: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Christina |
||
| Line 1: | Line 1: | ||
=cdh3= | =cdh3= | ||
This is the community wiki page for the gene ''cdh1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''cdh1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase. | ||
==Available Reagents | =nomenclature changes= | ||
11/07/2016 | |||
Human name has changed for Entrez Gene: 1001. From cadherin 3, type 1, P-cadherin (placental) to cadherin 3 | |||
=Available Reagents= | |||
==Morpholino Oligonucleotides== | |||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
Latest revision as of 08:06, 18 November 2016
cdh3
This is the community wiki page for the gene cdh1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
11/07/2016 Human name has changed for Entrez Gene: 1001. From cadherin 3, type 1, P-cadherin (placental) to cadherin 3
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CCACCGTCCCGAACAGAAGCCTCAT
which were used in [1]