XB-FEAT-484970: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Kevin
No edit summary
imported>Christina
Line 1: Line 1:
=cer1=  
=cer1=  
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''cer1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
=nomenclature changes=
HGNC records the following previous names and synonyms for cer1:
"cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)",
"cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"


==Available Reagents==
==Available Reagents==

Revision as of 11:27, 6 August 2015

cer1

This is the community wiki page for the gene cer1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

HGNC records the following previous names and synonyms for cer1: "cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)", "cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CTAGACCCTGCAGTGTTTCTGAGCG

which were used in [1]