XB-FEAT-5719326: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Kevin No edit summary |
||
| Line 7: | Line 7: | ||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
TGACGGCTTTTCCTCTGCCCGACAT <br /> | TGACGGCTTTTCCTCTGCCCGACAT <br /> | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | |||
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive. | This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive. | ||
Revision as of 11:05, 19 November 2012
hist2h2ab
This is the community wiki page for the gene hist2h2ab please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol H2AFX and may therefore be cross-reactive.