XB-FEAT-481479: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
imported>Kevin
No edit summary
Line 1: Line 1:
=csnk1e=  
=csnk1e=  
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
==Available Reagents==
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
TCCCCACTCTCAGCTCCATGTTTAC <br />
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014]

Revision as of 10:02, 13 November 2012

csnk1e

This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC

which were used in [1]