XB-FEAT-481479: Difference between revisions
Jump to navigation
Jump to search
imported>Christina |
imported>Christina |
||
Line 2: | Line 2: | ||
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | =nomenclature changes= | ||
Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E | 01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E | ||
Changed symbol to csnk1e and added previous name as synonym | 01/6/15 Changed symbol to csnk1e and added previous name as synonym | ||
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E | |||
Revision as of 12:02, 21 January 2015
csnk1e
This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E 01/6/15 Changed symbol to csnk1e and added previous name as synonym 01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC
which were used in [1]