XB-FEAT-481479: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Christina
imported>Christina
Line 1: Line 1:
=csnk1e=  
=csnk1e=  
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''csnk1e'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
=nomenclature changes=
=nomenclature changes=
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

Revision as of 10:42, 9 March 2015

csnk1e

This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

nomenclature changes

01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E

01/6/15 Changed symbol to csnk1e and added previous name as synonym

01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC

which were used in [1]