XB-FEAT-481479: Difference between revisions
Jump to navigation
Jump to search
imported>Christina |
imported>Christina |
||
| Line 11: | Line 11: | ||
==Available Reagents== | ==Available Reagents== | ||
=Morpholino Oligonucleotides= | |||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
TCCCCACTCTCAGCTCCATGTTTAC <br /> | TCCCCACTCTCAGCTCCATGTTTAC <br /> | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7014] | ||
Revision as of 10:42, 9 March 2015
csnk1e
This is the community wiki page for the gene csnk1e please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
01/6/15 Human symbol has changed for genepage ID: 481479 From loc400927-csnk1e to CSNK1E
01/6/15 Changed symbol to csnk1e and added previous name as synonym
01/15/2015 Human symbol has changed for genepage ID: 481479 From csnk1e to LOC400927-CSNK1E
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TCCCCACTCTCAGCTCCATGTTTAC
which were used in [1]