XB-FEAT-486800: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Kevin No edit summary |
||
| Line 2: | Line 2: | ||
This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''pax2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
Morpholinos have been designed for this gene with sequences | Morpholinos have been designed for this gene with sequences <br /> | ||
TGCAGTGCATATCCATGGGGAGGCA | TGCAGTGCATATCCATGGGGAGGCA <br /> | ||
GGTCTGCCTTGCAGTGCATATCCAT | GGTCTGCCTTGCAGTGCATATCCAT | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202] | ||
Revision as of 11:00, 12 November 2012
pax2
This is the community wiki page for the gene pax2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Morpholinos have been designed for this gene with sequences
TGCAGTGCATATCCATGGGGAGGCA
GGTCTGCCTTGCAGTGCATATCCAT
which were used in [1]