XB-FEAT-854157: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Xenbase No edit summary |
||
| Line 15: | Line 15: | ||
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514] | which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=44514] | ||
=nomenclature changes= | |||
04/22/ 2016 | |||
Human name has changed for Entrez Gene: 7481. From wingless-type MMTV integration site family member 11 to Wnt family member 11 | |||
Latest revision as of 08:22, 22 May 2017
wnt11
This is the community wiki page for the gene wnt11 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CTTCATCTTCAAAACCCAATAACAA
and
ACTGTATCCAAAGAGAGTTCCGAGG
which was used in [4]
nomenclature changes
04/22/ 2016
Human name has changed for Entrez Gene: 7481. From wingless-type MMTV integration site family member 11 to Wnt family member 11