XB-FEAT-855461: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Xenbase (→tcf7) |
||
Line 2: | Line 2: | ||
This is the community wiki page for the gene ''tcf7'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''tcf7'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=Morpholinos= | |||
the following Morpholino was designed for this gene with a sequence <br /> | |||
CGGCGCTGTTCATTTGGGGCAT<br /> | |||
This MO was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202], [http://www.xenbase.org/literature/article.do?method=display&articleId=1087], [http://www.xenbase.org/literature/article.do?method=display&articleId=45318] | |||
=nomenclature changes= | |||
05/15/2017 | |||
Human name has changed for Entrez Gene: 6932. From transcription factor 7 (T-cell specific, HMG-box) to transcription factor 7 |
Latest revision as of 08:38, 16 May 2017
tcf7
This is the community wiki page for the gene tcf7 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Morpholinos
the following Morpholino was designed for this gene with a sequence
CGGCGCTGTTCATTTGGGGCAT
This MO was used in [1], [2], [3]
nomenclature changes
05/15/2017 Human name has changed for Entrez Gene: 6932. From transcription factor 7 (T-cell specific, HMG-box) to transcription factor 7