XB-FEAT-855943: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin |
||
Line 1: | Line 1: | ||
=h2afx= | =h2afx= | ||
This is the community wiki page for the gene ''h2afx'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''h2afx'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | |||
TGACGGCTTTTCCTCTGCCCGACAT <br /> | |||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | |||
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive. |
Revision as of 12:09, 19 November 2012
h2afx
This is the community wiki page for the gene h2afx please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.