XB-FEAT-855943: Difference between revisions
imported>JoshuaFortriede |
imported>Xenbase |
||
Line 3: | Line 3: | ||
==Nomenclature == | ==Nomenclature == | ||
=nomenclature changes= | |||
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. | On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. | ||
08.23.2019 | |||
Human symbol has changed for genepage ID: 855943 From h2afxl to h2aX | |||
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX | |||
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | |||
08.26.19 | |||
As Xenopus follows human nomenlcature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl | |||
==Available Reagents== | ==Available Reagents== |
Revision as of 08:50, 26 August 2019
h2afxl
This is the community wiki page for the gene h2afxl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Nomenclature
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
08.23.2019
Human symbol has changed for genepage ID: 855943 From h2afxl to h2aX Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
08.26.19 As Xenopus follows human nomenlcature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.