XB-FEAT-855943: Difference between revisions
imported>Xenbase |
imported>Xenbase |
||
| Line 7: | Line 7: | ||
08.23.2019 | 08.23.2019 | ||
Human symbol has changed for | Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX | ||
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX | Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX | ||
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | ||
08.26.19 | 08.26.19 | ||
As Xenopus follows human | As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl | ||
==Available Reagents== | ==Available Reagents== | ||
| Line 22: | Line 25: | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | ||
This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive. | This sequence is shared by gene symbol hist2h2ab and may, therefore, be cross-reactive. | ||
Revision as of 11:24, 23 October 2019
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
08.23.2019
Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
08.26.19
As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene symbol hist2h2ab and may, therefore, be cross-reactive.