XB-FEAT-855943: Difference between revisions
imported>Xenbase |
|||
| Line 3: | Line 3: | ||
=nomenclature changes= | =nomenclature changes= | ||
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. | On 7/3/2019, this gene was changed from ''h2afx'' to ''h2afxl'' to designate that it is a like gene. | ||
08.23.2019 | 08.23.2019 | ||
| Line 13: | Line 13: | ||
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | ||
08.26.19 | |||
As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''. | |||
=nomenclature changes= | |||
17JULY2022 | |||
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) | |||
''Xenopus'' gene changed from ''h2axl'' to ''h2ax'' | |||
Note: this page had a few typos with dots (.) in in gene symbols. These have been removed. | |||
==Available Reagents== | ==Available Reagents== | ||
| Line 25: | Line 30: | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | ||
This sequence is shared by gene | This sequence is shared by gene ''hist2h2ab'' and may, therefore, be cross-reactive. | ||
Revision as of 13:54, 28 July 2022
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.
08.23.2019
Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
08.26.19 As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl.
nomenclature changes
17JULY2022 Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) Xenopus gene changed from h2axl to h2ax Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.